Learning Labs:   Bioinformatics

This is how you would do a BLAST search at the National Center for Biotechnical Information (NCBI) using the D16S539 forward primer ...

Tab bar

Primer List BLAST Search

  1. Go to BLAST [URL: http://www.ncbi.nlm.nih.gov/blast/]
  2. Paste copied "forward primer" sequence into space, begin the search, and wait 30 seconds...

To save time we have done this search for you. Here is the result of the search with only the bare essentials shown. Note there were 25 "hits." Some of these were descriptions of the short tandem repeat (STR) in smaller sequences. Since we wanted a hit sequence that would give us the STR and allow us to search the human genome, we selected a chromosome 16 clone for you to see. The detailed published sequence page for this hit can be seen by clicking on either link. But, before clicking, read all of the directions at the bottom of this page.

NCBIBlast

Blast (nucleotide-nucleotide) search with D16 primer Alignments (1 of 25)

>gi|18057076|gb|AC024591.4| Download subject sequence spanning the HSP   Homo sapiens chromosome 16 clone RP11-511G21,
complete sequence Length = 104680
Score = 48.1 bits (24), Expect = 1e-04
Identities = 24/24 (100%)
Strand = Plus / Plus

Query: 1     gggggtctaagagcttgtaaaaag 24
             ||||||||||||||||||||||||
Sbjct: 10548 gggggtctaagagcttgtaaaaag 10571

DIRECTIONS [read them all before you start!]

TO SEARCH THE HUMAN GENOME FOR STR SITE USING "ENSEMBL":

  1. Write down the number of the base that corresponds to the STR forward primer in the clone's sequence. It is the number after "Sbjct:"
  2. Click on the link for the hit (it starts: gi | 18057076...). You will be taken to the NCBI page that has details about the clone and at the bottom of the page you will see the entire sequence of 104,680 bases.
  3. Go to the region corresponding to the forward primer in the sequence (the Sbjct number) and look for the forward primer sequence. We copied this sequence plus about 300 bases to a page so you can search for the STR (see step 6).
  4. Open a new browser page by clicking the link in #6 with directions for the rest of the exercise before completing steps 4 and 5.
  5. When you are on the Ensembl BLAST page, paste the forward primer sequence into the space provided. Check that "dna queries" and "dna database" are selected. Check that "homo sapiens" is highlighted and "BLASTN" is highlighted. Then click "Run". It will take seconds to minutes for your search to be completed and you can work on the STR challenge while you are waiting. When you think you are ready to look for your STR in the human genome, click the "Retrieve" button and then you can click the "View" button and see where your BLASTN search took you. You will see the 23 human chromosomes and multiple "hits" for the forward primer with arrows pointing to where on a chromosome the hit resides. Click on the arrow and then click on the "alignment" and you will open a page that shows the alignment for the hit you have selected. If polymerase chain reaction (PCR) works there should only be a single PERFECT alignment. Check to be sure this is true by looking at several of the hits on chromosomes other than 16. How do the hits that are not perfect differ? Now find the hit on chromosome 16 with a box surrounding the hit. This is the site of the STR and the alignment should be perfect. This is the only place in the entire human genome where the 24 base sequence of the forward primer for D16S539 will anneal and PCR will proceed. You can see the sequence in the "contig" view to look for the STR [you will have to recall how Dr. Allan did this with you during your bioinformatics exercise at the lab since the steps are too complicated to detail here].
  6. Click the link to open another browser page with an exercise to do while you are waiting for your in silico PCR search - The STR sequence challenge.

Next: Sequence Challenge